Volume 17, Issue 1 e14373
RESEARCH ARTICLE
Open Access

Electrical current disrupts the electron transfer in defined consortia

Mon Oo Yee

Mon Oo Yee

Nordcee, Department of Biology, University of Southern Denmark, Odense, Denmark

Nature Energy, Odense, Denmark

Contribution: Conceptualization (equal), Data curation (equal), Formal analysis (lead), ​Investigation (lead), Methodology (lead), Validation (equal), Visualization (equal), Writing - original draft (lead), Writing - review & editing (supporting)

Search for more papers by this author
Lars D. M. Ottosen

Lars D. M. Ottosen

Department of Engineering, University of Aarhus, Aarhus, Denmark

Contribution: Conceptualization (supporting), Funding acquisition (lead), Project administration (supporting), Supervision (supporting), Writing - review & editing (supporting)

Search for more papers by this author
Amelia-Elena Rotaru

Corresponding Author

Amelia-Elena Rotaru

Nordcee, Department of Biology, University of Southern Denmark, Odense, Denmark

Correspondence

Amelia-Elena Rotaru, Nordcee, Department of Biology, University of Southern Denmark, Odense, Denmark.

Email: [email protected]

Contribution: Conceptualization (equal), Data curation (equal), Formal analysis (supporting), Funding acquisition (supporting), ​Investigation (supporting), Methodology (supporting), Project administration (lead), Resources (lead), Supervision (lead), Validation (lead), Visualization (lead), Writing - original draft (supporting), Writing - review & editing (lead)

Search for more papers by this author
First published: 09 December 2023

Abstract

Improving methane production through electrical current application to anaerobic digesters has garnered interest in optimizing such microbial electrochemical technologies, with claims suggesting direct interspecies electron transfer (DIET) at the cathode enhances methane yield. However, previous studies with mixed microbial communities only reported interspecies interactions based on species co-occurrence at the cathode, lacking insight into how a poised cathode influences well-defined DIET-based partnerships. To address this, we investigated the impact of continuous and discontinuous exposure to a poised cathode (−0.7 V vs. standard hydrogen electrode) on a defined consortium of Geobacter metallireducens and Methanosarcina barkeri, known for their DIET capabilities. The physiology of DIET consortia exposed to electrical current was compared to that of unexposed consortia. In current-exposed incubations, overall metabolic activity and cell numbers for both partners declined. The consortium, receiving electrons from the poised cathode, accumulated acetate and hydrogen, with only 32% of the recovered electrons allocated to methane production. Discontinuous exposure intensified these detrimental effects. Conversely, unexposed control reactors efficiently converted ethanol to methane, transiently accumulating acetate and recovering 88% of electrons in methane. Our results demonstrate the overall detrimental effect of electrochemical stimulation on a DIET consortium. Besides, the data indicate that the presence of an alternative electron donor (cathode) hinders efficient electron retrieval by the methanogen from Geobacter, and induces catabolic repression of oxidative metabolism in Geobacter. This study emphasizes understanding specific DIET-based interactions to enhance methane production during electrical stimulation, providing insights for optimizing tailored interspecies partnerships in microbial electrochemical technologies.

INTRODUCTION

Future applications aim to enhance sustainable biogas upgrading by integrating anaerobic digestion (AD) with microbial electrocatalysis (MEC). This integration combines the breakdown of organic matter through AD to produce biogas (almost equimolar gas mixture of CO2:CH4) with MEC where renewable energy and microorganisms from AD are used as catalysts to convert CO2 into high-purity methane – a clean fuel. The potential benefits of this approach include improved efficiency, increased sustainability, and enhanced energy recovery from organic waste (Horváth-Gönczi et al., 2023; Wang et al., 2022). However, practical implementation requires understanding microbial interactions at the electrode surface and their impact on methane formation.

Application of electrical current to anaerobic digesters or MEC-AD resulted in a significant increase in methane production (Wang et al., 2022). Because electroactive bacteria and electroactive methanogens were coexisting on cathodes in MEC-AD, researchers often speculate that direct interspecies electron transfer (DIET) between electroactive bacteria and archaea at the cathode is a possible reason for improved methanogenesis (Bretschger et al., 2015; Jiang et al., 2022; Liu et al., 2016; Lu et al., 2023; Wang et al., 2020, 2022; Wei et al., 2023; Zhao et al., 2015, 2016, 2022). To investigate whether DIET partnerships are indeed the key drivers behind enhanced methanogenesis in MEC-AD, fundamental insights into how electrochemical exposure impacts defined DIET interspecies associations are required.

To address this goal, a defined DIET consortium of Geobacter metallireducens and Methanosarcina barkeri serves as an ideal model system (Rotaru et al., 2014). In this consortium, the Geobacter oxidizes organic substrate and donates electrons to Methanosarcina. Yet, without an electron sink, Geobacter's oxidative metabolism becomes unfavourable. In DIET, the methanogen acts as the sink, relying on Geobacter's electrons for reductive metabolism, converting CO2 to methane. Without Geobacter, the methanogen could not grow on ethanol alone (Rotaru et al., 2014). Methanosarcina species are prevalent in anaerobic digesters (De Vrieze et al., 2012) exhibiting a versatile metabolism, utilizing methylated compounds, acetate, hydrogen (Costa & Leigh, 2014), and even electrons directly when in partnership with syntrophic bacteria such as Geobacter (Wang et al., 2021). Previously, DIET interactions were established between Geobacter metallireducens and multiple Methanosarcina species commonly found in anaerobic digesters, including M. barkeri and M. mazei (Yee & Rotaru, 2020). Additionally, these Methanosarcina species demonstrated electromethanogenesis by directly receiving electrons from a cathode (Rowe et al., 2019; Yee et al., 2019; Yee & Rotaru, 2020).

One of the critical parameters influencing electromethanogenesis in MEC-AD is the cathode potential. A more negative cathode potential has been linked to increased methane production (Kim et al., 2022; Zhang et al., 2022; Zhen et al., 2016). Although methanogens generally thrive under negative electrode potentials, subjecting bacteria to negative potentials is often detrimental especially to biofilm formation. This is a widely adopted strategy in various industries to control biofouling (Sultana et al., 2015). Particularly, when a Geobacter was exposed to a negative electrode potential, it adversely affected its metabolism, leading to a buildup of reduced electron carriers, such as NAD(P)H, which can impede extracellular electron transfer and disrupt redox homeostasis (Korth & Harnisch, 2019; Song et al., 2016).

Understanding the physiological and dynamic response of the DIET partners when electrical current is applied could provide valuable insights for designing tailor-made consortia for MEC-AD or other upcoming biogas upgrading technologies relying on microbial electrosynthesis.

Contrary to prevailing beliefs in MEC-AD studies, our hypothesis is that exposure to a cathodic potential leads to a metabolic decoupling of the DIET partners by providing a competitive electron donor for the methanogen (the cathode) and inhibiting the oxidative metabolism of the syntroph.

To explore this hypothesis, our study aimed to address the following key research questions: What is the impact of high-potential electrons at −0.7 V delivered by a cathode on partners of a syntrophic consortia of Geobacter metallireducens and Methanosarcina barkeri? Can we observe a potential decoupling of these two partner organisms, and if so, how does it affect their respective metabolisms and cell distributions? Does the methanogen transition to utilizing cathodic electrons rather than relying on DIET electrons provided by Geobacter? What are the potential negative effects, if any, due to exposure to a negative cathodic potential?

The findings presented in this work enhance our understanding of the impact of cathodic exposure on syntrophic partners and the perspectives of employing syntrophic consortia for sustainable and efficient biogas upgrading in MEC-AD systems.

EXPERIMENTAL PROCEDURES

Experimental design

To test our hypothesis, double-chambered bio-electrochemical reactors (Figure 1A) were operated with cathodes poised at −0.7 V continuously or discontinuously (switched on/off at 5-day intervals). The reactors were inoculated with a preadapted co-culture of Geobacter metallireducens and Methanosarcina barkeri. The reactors were initially under a typical co-culture atmosphere (80:20, N2:CO2) and were then switched to a typical biogas digester atmosphere (50:50, CO2:CH4). This setup aimed to assess the effect of increased CO2 on DIET metabolism and electromethanogenesis. Every 5 days, the following parameters were determined: methane formation, ethanol consumption, and hydrogen buildup, while every 10 days cell numbers were estimated by real-time PCR. Disruptions in electrical current exposure were tested to assess whether Geobacter would benefit from gaps in exposure restoring its oxidative metabolism.

Details are in the caption following the image
Schematic representation of the reactors and the treatment strategies used to investigate the response of a DIET consortium of Geobacter metallireducens and Methanosarcina barkeri to applied electrical current (−0.7 V). (A) Reactor setup and possible interactions between species and cathode. (B) DIET control: The DIET consortium is grown in the bioelectrochemical reactors but remains unexposed to −0.7 V (n = 3 until day 10; n = 2 days 10–20). IC) DIET at −0.7 V continuous: The DIET consortium is provided with a continuous supply of ethanol (≥1 mM) and is exposed continuously to −0.7 V (n = 4). (D) DIET at −0.7 V intermittent: The DIET consortium is provided with a continuous supply of ethanol (≥1 mM), but the cathodic potential is switched off after the first 5 days and then turned back on and off every 5 days (n = 3). (E) DIET or −0.7 V intermittent: The DIET consortium is provided with −0.7 V the first 5 days and ethanol (≥1 mM) the next 5 days; then, this is repeated until day 20 (n = 4) (created in BioRender).
To investigate the influence of negative cathodic potential on DIET consortia, we subjected them to four exposure treatments (Figure 1B–E), evaluating their metabolism and cell ratios over a 20-day incubation period.
  1. Control without exposure (Figure 1B), where a DIET consortium was grown on ethanol without any cathodic exposure.
  2. Continuous exposure of DIET consortia grown on ethanol and exposed to −0.7 V at all times (Figure 1C). Ethanol serves as the electron donor for both partners, while the cathode (−0.7 V) is exclusively favourable for the methanogen. This condition mirrors the MEC-AD settings with methanogens receiving electrons from both syntrophic partners and cathodes.
  3. Discontinuous exposure of DIET consortia grown on ethanol and exposed to −0.7 V with periodic breaks intended for redox homeostasis regeneration in Geobacter (Figure 1D). Negative potentials, as reported in the literature (Korth & Harnisch, 2019; Song et al., 2016), are known to disrupt electron transfer, causing an accumulation of reduced NAD(P)H.
  4. Discontinuous exposure of DIET consortia to ethanol or −0.7 V (Figure 1E). We were interested in determining whether the partners could be decoupled by switching from conditions favourable for the growth of both (ethanol-fed) to conditions solely favourable for one (−0.7 V).

Cultivation conditions

Methanosarcina barkeri MS (DSM 800) and Geobacter metallireducens GS-15 (DSM 7210) were obtained from the German culture collection, DSMZ. In our previous work, these two species were co-cultured in the presence of granular activated carbon (GAC, 25 g/L) (Yee et al., 2019). For this study, the fifth transfer of this GAC-adapted co-culture was used. The decision to use a GAC-adapted co-culture was based on its higher growth rates and pre-adaption to a carbonaceous surface, which is comparable to a cathode surface. The growth experiments were conducted in a previously reported basal medium (Yee et al., 2019) under strict anaerobic and sterile conditions.

Bioelectrochemical reactor set-up and measurements

Two-chambered H-cell reactors (Adams and Chittenden Scientific Glass, USA) were set up without stirring to minimize electrochemical signal noise, following the previously reported methodology (Yee et al., 2019, 2020). Each chamber, with a total volume of 0.65 L, was separated by a Nafion™ proton exchange membrane (Ion Power). Both working and counter electrodes were graphite rods (2.5 × 7.5 × 1.2 cm), and reference electrodes were leak-free Ag/AgCl (3.4 M KCl) electrodes from CMA Microdialysis, Sweden. The Ag/AgCl electrodes had a potential difference of +0.24 V against SHE as validated by the manufacturer and our laboratory. For controlled cathodic potentials and chronoamperometry, a multi-channel potentiostat (MultiEmStat, PalmSens, The Netherlands) was used. A total of 0.11 L of a late exponential co-culture was anaerobically added to each cathodic chamber, which contained 0.44 L of sterile anaerobic medium. This resulted in a final solution volume of 0.55 L, leaving 0.1 L headspace.

Four distinct treatment strategies were employed in this study: (1) ethanol only (DIET control), (2) ethanol and −0.7 V continuous, (3) ethanol and −0.7 V discontinuous, and (4) ethanol or −0.7 V discontinuous (Figure 1B–E). Ethanol served as the ‘feed’ and was carefully maintained at concentrations above 1 mM by topping up, when necessary, which occurred on day 10. The control treatment, referred to as DIET, was only provided with ethanol, without any electrical current application. All treatments with electrical current application had their cathodes poised at −0.7 V (vs. SHE) over the entire period of the incubation of 20 days for −0.7 V continuous, or at 5-day intervals for the −0.7 V discontinuous. During the initial 10 days (phase 1), all incubations were carried out under an 80:20 N2:CO2 atmosphere in the headspace. Subsequently (phase 2), the atmosphere was changed to a biogas-mimicking gas mixture of 50:50 CH4:CO2, through a 20-minute gas exchange, and incubations continued for another 10 days. Each treatment condition was set up in four replicate reactors, but due to technical issues, triplicate (first 10-days) and, then, duplicate (next 10-days) reactors were used for the DIET control treatment. Triplicate abiotic reactors were also included for the −0.7 V continuous and −0.7 V discontinuous treatments, with ethanol added only at the beginning.

All cultivations were carried out at 37°C in temperature-controlled incubators.

Analytical measurements

Methane (CH4), hydrogen gas (H2), and ethanol concentrations were quantified by gas chromatography against defined standards, as previously described (Yee et al., 2019).

Acetate concentrations were measured by ion chromatography against defined standards, as previously described (Yee et al., 2019).

DNA extraction

For DNA extraction, anaerobic sampling was performed using hypodermic syringes and needles from the side ports of the bioelectrochemical reactors. A 20 mL sample was collected from the inoculum prior to addition to the bioelectrochemical reactors. For the inoculum, four technical replicates were retrieved. For each condition, 2–4 biological replicates were sampled for DNA extractions every 10 days. The collected samples were centrifuged at 5000 g for 15 min at 4°C, and the resulting cell pellets were frozen for subsequent DNA extraction. DNA extraction from the frozen pellets was carried out using the MasterPure™ DNA Purification Kit (Epicentre, USA) following the manufacturer's protocol. The resulting DNA was eluted in 35 μL TE buffer.

Real-time PCR (quantitative PCR)

To prepare standards for real-time PCR (qPCR), genomic DNA of pure cultures of G. metallireducens and M. barkeri was extracted following the same method described in the previous section; specific fragments were amplified, cloned, and diluted to generate eight standards for each. To detect G. metallireducens, primers specific for Geobacteriaceae 16S rRNA (GEO_494F; 5′ AGGAAGCACCGGCTAACTCC 3′ and GEO_825R; 5′ TACCCGCRACACCTAGT 3′) were used as previously described by Holmes et al. (2002). For M. barkeri, the Methanosarcinaceae 16S rRNA-specific primer pair (MSC_380F; 5′ GAAACCGYGATAAGGGGA 3′ and MSC_828R; 5′ TAGCGARCATCGTTTACG 3′) were used as instructed by Yu et al. (2005).

The PCR was prepared in a final volume of 50 μL, containing 30.75 μL PCR-grade water, 5 μL of dNTP (2 mM), 5 μL of MgCl2 (25 mM), 1 μL each of forward and reverser primers, 5 μL Taq polymerase buffer (10×), 1 μL of genomic DNA as the template, 1 μL of bovine serum albumin (BSA), and 0.25 μL of Taq polymerase (5 U/μL) from Invitrogen. The PCR amplification was performed as follows: (1) a hot start at 94°C for 10 min, (2) denaturation at 94°C for 45 s, (3) annealing at 55°C for 45 s for Geobacter primers and at 50°C for Methanosarcina primers, and (4) extension at 72°C for 45 s. Steps 2–4 were repeated for 35 cycles followed by a final extension step at 72°C for 10 min.

The PCR amplicons were purified using 1.2% agarose gel electrophoresis in TAE buffer, followed by gel extraction using QIAEX II Gel Extraction Kit according to the manufacturer's protocol. The purified PCR product was then ligated into pCR™4-TOPO™ vector from TOPO™ TA Cloning™ Kit and transformed into TOP10 Chemically Competent Escherichia coli cells (Thermo Fisher Scientific) following the manufacturer's instructions. Transformed cells were selected on LB agar plates with ampicillin (100 μg/mL) and kanamycin (50 μg/mL). Colonies were PCR screened, and plasmids were extracted and quantified by Quant-iT™ PicoGreen™ dsDNA Assay Kit (Invitrogen). Eight standards were prepared (from 108 to 100 copies) for subsequent quantitative PCR.

Geobacter and Methanosarcina from the DNA extracted from the bioelectrochemical reactors were amplified using the same specific primer pairs. Each reactor sample was analysed alongside corresponding standards, as explained above. The real-time PCR mix was prepared in a 25 μL final volume, comprising 12.5 μL of RealQ Plus 2× Master Mix (Denmark), 0.5 μL of specific forward or reverse primer (20 μM), 1 μL template, and PCR-grade water to reach the desired volume.

The real-time PCR amplification followed these steps: (1) initial denaturation at 95°C for 15 min, (2) denaturation at 95°C for 30 s, (3) annealing at 55°C for 30 s for Geobacter primers or at 50°C for Methanosarcina primers, and (4) extension at 72°C for 30 s. Steps 2–4 were repeated for 40 cycles. Before termination, the PCR sample was subjected to a melt curve analysis by treating it at 95°C for 5 min. All biological replicates from bioelectrochemical reactors were analysed in technical duplicates.

Cell numbers were estimated using a ratio of 16S rRNA copies/mL to the number of 16S rRNA copies per genome of the respective cell. Notably, Geobacter metallireducens possesses two 16S rRNA genes per genome, while Methanosarcina barkeri has three 16S rRNA genes per genome.

RESULTS AND DISCUSSION

Our hypothesis was that exposing DIET consortia to a poised cathode at −0.7 V would disrupt the oxidative metabolism of the syntrophic partner, challenging prevailing beliefs in MEC-AD studies. We aimed to investigate whether a −0.7 V exposure would decouple the oxidative metabolism of Geobacter from the reductive metabolism of Methanosarcina, with the expectation of a decrease in the former and an increase in the latter. However, our findings revealed a surprising decline in both oxidative metabolism and reductive metabolism at −0.7 V (Table 1), suggesting general metabolic constraints for both partners. Consequently, it is unlikely that DIET consortia exposed to electrical current can account for enhanced methanogenesis in MEC-AD.

TABLE 1. Electron recoveries from ethanol and cathode into products, such as acetate, hydrogen gas, and methane, by DIET consortia without or after exposure to electrical current (−0.7 V).
Condition Cathodic electrons (mM eq.) Electrons from oxidized ethanol (mM eq.) Decrease below control (p-value) Electron recovery in acetate (mM eq.) Increase above control (p-value) Electron recovery in hydrogen (mM eq.) Increase above control (p-value) Electron recovery in methane (mM eq.) Decrease below control (p-value) % Electron recovery of electrons from ethanol as methane (as a fraction of products) Total electron recovery in products (%)
DIET control None 61.8 ± 4.5 4.3 ± 2.5 0.0 ± 0.0 32.7 ± 2.4 ~53 (88%) ~60
DIET at −0.7 V cont. 15.9 ± 3.1 50.1 ± 4.4 1.2-fold (0.047) 32.6 ± 0.8 8-fold (0.015) 1.8 ± 0.8 121-fold (0.009) 15.9 ± 6.1 2-fold (0.004) ~24 (32%) ~76
DIET at −0.7 V int. 6.4 ± 5.6 44.3 ± 4.6 1.4-fold (0.020) 32.2 ± 1.7 8-fold (0.005) 2.2 ± 1.5 146-fold (0.065) 6.9 ± 3.6 5-fold (0.001) ~14 (17%) ~82
DIET or −0.7 V int. 7.0 ± 2.0 31.7 ± 4.1 1.9-fold (0.000) 20.6 ± 1.3 5-fold (0.021) 1.6 ± 0.6 103-fold (0.006) 12.2 ± 4.1 3-fold (0.001) ~32 (36%) ~89
  • Note: Representative chronoamperometry under all conditions, alongside abiotic controls, can be found in Figure S3A–E.

Exposure to –0.7 V disrupts oxidative metabolism in DIET consortia

Exposure to a negative potential of −0.7 V resulted in a minor reduction in ethanol oxidation compared to control DIET consortia (p = 0.3, Figure 2A, Table 1). However, interruption of −0.7 V application led to a noticeable halt in ethanol oxidation (p < 0.05, Tables 1S1, S2). This was surprising, because a gap in exposure was expected to give Geobacter time to regenerate its oxidized electron carriers, such as NAD(P)+. Ethanol consumption remained detectable in all incubations with cells but was close to the detection limit in abiotic controls (Figure 2B).

Details are in the caption following the image
Ethanol and acetate metabolism of a DIET consortium of Geobacter metallireducens and Methanosarcina barkeri with or without exposure to electrical current (−0.7 V). (A) Ethanol oxidation profiles in reactors provided with cells. (B) Ethanol oxidation profiles in abiotic reactors without cells. (C) Accumulation of acetate in reactors with cells. All conditions were carried out at least in triplicate (n = 3); the exceptions were with one control DIET reactor lost during gas transfer at day 10 (n = 2, from day 12) and the abiotic at −0.7 V intermittent (n = 2).

The most significant drop in ethanol oxidation occurred when shifting from an 80:20 N2:CO2 to a 50:50 CH4:CO2 biogas atmosphere, where ethanol consumption for −0.7 V-exposed consortia was half that of control DIET consortia (p < 0.05, Tables 1, S1, S2). Thermodynamically, ethanol conversion to methane is less favourable under the biogas atmosphere (Table S3). The decline in ethanol oxidation may be attributed to a thermodynamic shift due to abundant reaction products, a pH decrease, or a negative impact of elevated CO2 on Geobacter's metabolism. There is minimal pH variation (0.16 ± 0.08 pH units) when transitioning to a high CO2 (50%) atmosphere, with media pH remaining above 6.7, well within the optimal range for both Geobacter and Methanosarcina, suggesting that pH plays an insignificant role. On the other hand, Geobacter's oxidative metabolism could be negatively affected by elevated CO2 in line with previous reports on syntrophic bacteria (Ceron-Chafla et al., 2020; Jin & Kirk, 2016; Kato et al., 2014) likely due to thermodynamic limitations (Table S3). These findings indicate that Geobacter is sensitive to cumulative changes in their environment – such as negative cathodic potentials and elevated CO2 from biogas.

The negative impact of electrical current on the oxidative metabolism of the consortia was further substantiated by the significant inhibition of acetate utilization (Figure 2C, Table S4). Continuous exposure to −0.7 V increased acetate accumulation by 1.8-fold (under 80:20 N2:CO2) or a staggering 9.8-fold (under 50:50 CH4:CO2) compared to control DIET consortia (p < 0.05, Figure 2C, Table S4). Interrupting the electrical current did not restore acetate utilization, regardless of the gas phase (dotted lines in Figure 2C). Only intermittent ethanol addition showed lower acetate accumulation due to a lower ethanol supply (Figure 2A). Unlike DIET consortia where the acetate to ethanol ratio goes quickly from 1 to zero (Figure S1), cultures exposed to −0.7 V maintained a stable acetate to ethanol ratio of 1, denoting impaired acetate metabolism during the 20-day incubation (Figure S1).

In these consortia, acetate could serve two purposes: (i) methanogenic substrate for Methanosarcina or (ii) electron donor for G. metallireducens when it has an effective DIET partner (Rotaru et al., 2018; Wang et al., 2016). Thus, there are two possible reasons for acetate accumulating when cultures are exposed to −0.7 V: Consumption by acetoclastic methanogenesis becomes unfavourable when cathodic H2 becomes available, or syntrophic acetate oxidation becomes unfavourable when cathodic H2 becomes available.

Under standard conditions, hydrogenotrophic methanogenesis has a 55 kJ/mol favourability (Table S3) over acetoclastic methanogenesis. However, in our reactor conditions, regardless of the gaseous atmosphere, acetoclastic methanogenesis becomes rapidly more favourable than hydrogenotrophic methanogenesis. In a typical co-culture atmosphere, acetoclastic methanogenesis surpasses hydrogenotrophic methanogenesis when acetate exceeds 0.5 mM (Figure 3A). In a biogas atmosphere, it becomes more favourable once acetate exceeds 2.5 mM (Figure 3B). Since acetate exceeds these thresholds quickly or right at the incubation onset in both conditions, exposure to −0.7 V does not appear to hinder acetoclastic methanogenesis. And yet, acetate is not consumed by consortia exposed to −0.7 V.

Details are in the caption following the image
Gibbs free energy for acetoclastic methanogenesis (black lines) and hydrogenotrophic methanogenesis (red lines) at varied acetate concentrations under (A) a normal co-culture atmosphere containing 20% CO2 and 80% N2, and (B) a biogas atmosphere containing 50% CO2 and 50% CH4 (see detailed parameter information in Table S3).

Possibly, acetate accumulates because −0.7 V obstructs Geobacter's ability to perform syntrophic acetate oxidation due to the presence of an alternative electron donor (cathodic H2) for the methanogenic partner. This aligns with the literature indicating such inhibition of syntrophic metabolism (Wu et al., 1996). Moreover, Geobacter exhibits a higher acetate affinity (half-saturation constant/KM = 0.01–1 mM) (Esteve-Nunez et al., 2005) compared to Methanosarcina barkeri (KM = 4 to 5 mM) (Smith & Mah, 1978; Westermann et al., 1989). Given that acetate accumulation remains below the KM of M. barkeri, Geobacter is the likely primary contributor to acetate utilization. Consequently, the severe acetate accumulation observed at −0.7 V likely results from severe alterations in Geobacter's acetate metabolism.

Exposure to −0.7 V Induces H2 accumulation

Hydrogen buildup occurred strictly when cathodes were poised. Abiotic controls exposed to −0.7 V accumulated more H2 when exposed continuously to −0.7 V rather than intermittently (6.2-fold, p = 0.008), consistent with electrochemical H2 production, independent of the overlying atmosphere (80:20 N2:CO2 or biogas 50:50 CH4:CO2). However, the H2 buildup doubled in the abiotic reactors under the biogas atmosphere (p = 0.01 at −0.7 V continuous). This is most likely due to the elevated CO2 forming carbonic acid, which can then dissociate into protons (H+) and carbonate ions (CO32−) (Bajracharya et al., 2015). The marginal pH decrease (−0.16 ± 0.08 pH units) upon switching to a biogas atmosphere may possibly boost proton (H+) availability at the cathodic surface, leading to increased H2 evolution at −0.7 V.

Contrariwise, DIET control experiments without poised cathodes showed no H2 accumulation, confirming their H2-independent nature (Figure 4A).

Details are in the caption following the image
Hydrogen accumulation and methane formation by a DIET consortium with or without exposure to electrical current (−0.7 V). (A) Hydrogen accumulation profiles in reactors with cells. (B) Hydrogen accumulation profiles in abiotic reactors without cells. (C) Methane formation in reactors with cells. Data represent at least triplicate reactors for each condition (n ≥ 3), with one control DIET reactor lost during gas transfer at day 10 (n = 2 from day 12) and the abiotic at −0.7 V intermittent (n = 2). (B) Subfigure shows calculated values of expected methane from cathodic H2 assuming a 4:1 stoichiometry of H2 to methane according to the reaction: 4H2 + CO2 → CH4 + 2H2O.
Initially, it was expected that abiotic H2 formed at −0.7 V would be consumed by M. barkeri. Consequently, this would decouple M. barkeri from G. metallireducens in consortia exposed to −0.7 V. So, M. barkeri would favour cathodic H2/electrons (Rowe et al., 2019) over electrons from DIET with G. metallireducens. Contrary to our expectations, when first exposed to −0.7 V, the DIET consortia showed significant H2 accumulation compared to abiotic media controls (4-fold, p = 0.007, Figure 4A,B). This observation indicates that M. barkeri does not have an immediate preference for utilizing cathodic H2, suggesting limitations in M. barkeri's metabolic capability to use H2 as their electron donor while engaged in electron uptake from Geobacter. Furthermore, the 4-fold H2 accumulation above abiotic controls indicates that at −0.7 V, M. barkeri has abundant reduced ferredoxin (Fdred) and reduced F420 (F420H2) to produce excess extracellular H2 (Lovley, 2018) via reactions catalysed by two hydrogenases – the Ech hydrogenase and the Frh hydrogenase:
Ech hydrogenase membrane bound : Fd red + 2H + Fd ox + 2H 2 pumps 2 H + (1)
Frh hydrogenase intracellular : F 420 H 2 F 420 + H 2 (2)

Interestingly, when −0.7 V-treated DIET consortia were subjected to a 50:50 CH4:CO2 biogas atmosphere they accumulated less H2 than abiotic incubations without cells (Figure 4A,B). This strongly supports the notion that elevated CO2 levels promoted the consumption of H2 by Methanosarcina, aligning with the findings of other researchers regarding the impact of elevated CO2 on hydrogenotrophic methanogenesis (Garcia-Robledo et al., 2016). In conclusion, it appears that electron uptake at −0.7 V or H2 metabolism is not favoured by M. barkeri from DIET consortia, unless the atmosphere has elevated CO2, which promotes hydrogenotrophic methanogenesis (Garcia-Robledo et al., 2016).

Influence of exposure to −0.7 V on methane formation

In our experiments, the provision of additional extracellular electrons at −0.7 V to a DIET consortium resulted in a notable decline in methane buildup compared to control consortia, particularly evident under a biogas atmosphere (Figure 4C, p < 0.005 for all −0.7 V treatments). An increase in methane buildup above that of control DIET consortia was expected, assuming that cathodic H2 is unlimited and the primary driver for methane production, surpassing electron uptake by DIET (Figure 4B – inset).

Strikingly, DIET consortia exhibited a three-fold increase in methane production under elevated CO2 levels, regardless of cathodic exposure (Figure 4C, p ≤ 0.05). This is remarkable given that hydrogenotrophic methanogenesis is 90.5 kJ/mol less favourable under the 50:50 CO2:CH4 than under the N2:CO2 atmosphere. However, the higher diffusivity of CO2 in water compared to methane likely results in elevated CO2 concentrations promoting CO2-reductive methanogenesis. This is likely through stimulation of hydrogenotrophic pathways (Garcia-Robledo et al., 2016) or potentially by enhancing direct electron uptake. This connection is supported by increased methane buildup and minimal H2 detected under high CO2. Even in control experiments with DIET consortia unexposed to cathodic current, with H2 at the detection limit, elevated CO2 appears to promote electron uptake and increased methanogenesis.

Contrary to our expectations, cells exposed to −0.7 V did not exhibit the highest electron recovery in methane. The control DIET consortia directed electrons towards methane as its major sink for electrons (88% of the electrons recovered in products, Table 1). In contrast, all −0.7 V incubations directed a significant proportion of electrons towards acetate production (60%–78%), with methane (16%–33%) and even hydrogen gas (3%–5%) as limited electron sinks. These findings indicate a shift in metabolic pathways in response to −0.7 V exposure, diverting electrons towards acetate production rather than methane as originally anticipated.

In conclusion, our results challenge the prevailing notion that DIET associations are the primary drivers of enhanced methanogenesis in MEC-AD. Further investigations are essential to fully comprehend the intricate interactions of microorganisms on electrodes in MEC-AD, particularly under varying electrochemical conditions. The astonishing increase in methane accumulation under elevated CO2 levels regardless of cathodic exposure raises intriguing questions about the dual roles of CO2 in promoting hydrogenotrophic and DIET methanogenesis, warranting further exploration. These insights pave the way for a deeper understanding of the underlying mechanisms governing methane production in MEC-AD systems, offering valuable implications for optimizing and controlling these bioelectrochemical processes.

Impact of −0.7 V exposure on Geobacter and Methanosarcina

Negative cathodic potentials were expected to reduce the Geobacter population, given the adverse effects on oxidative metabolism. Our results confirmed this, as Geobacter's estimated abundance significantly decreased at −0.7 V compared to DIET controls (N2:CO2 atmosphere, p ≤ 0.05). Transitioning to a biogas atmosphere led to an even more dramatic decline in Geobacter's population at −0.7 V (13- to 37-fold lower than DIET controls, p ≤ 0.0001, Figure 5A).

Details are in the caption following the image
Cell abundance estimates of Geobacter and Methanosarcina in DIET consortia with and without exposure to −0.7 V as determined through analyses of 16S rRNA copy numbers. Cell abundance estimates were conducted at three critical steps: for the inoculum, after exposure to a typical co-culture atmosphere (80:20 N2:CO2) and after exposure to a biogas atmosphere (50:50 CH4:CO2). The estimation was done by dividing the quantified copy numbers of the 16S rRNA gene by the specific number of gene copies in the genome of each organism (two copies for G. metallireducens and three copies for M. barkeri). Abundance estimates of both (a) Geobacter and (b) Methanosarcina were derived from absolute 16S rRNA gene copy numbers detected using real-time PCR. The resulting box plots represent the interquartile range, with whiskers representing data variability. Outliers are displayed as small circles outside the box and whisker area. The line inside the box indicates the median, while the cross represents the mean. The data are derived from biological replicates (n > 3 for all conditions except the DIET control at 50% CO2, n = 2). Additional technical duplicates were performed for each biological replicate.

In accordance with our hypothesis, exposing a DIET consortium to −0.7 V was expected to decouple the partners, with a negative impact on Geobacter and a neutral or positive impact on Methanosarcina. Indeed, under an N2:CO2 atmosphere, Methanosarcina abundance at −0.7 V resembled DIET controls (p ≥ 0.1 for all conditions). Conversely, under a biogas atmosphere, Methanosarcina abundance at −0.7 V decreased significantly (2- to 6-fold below DIET controls, p ≤ 0.05, Figure 5B). This decline is inconsistent with the observed increase in methanogenic activity under a biogas atmosphere.

This discrepancy could be due to (i) increased metabolic rates per cell or (ii) electrode attachment. Our current quantification method does not account for cells attached to electrodes. However, physiological and thermodynamic considerations suggest that Methanosarcina primarily relies on cathodic H2/electrons and CO2 for methanogenesis in a biogas atmosphere. Greater reliance on cathodic electrons may facilitate cell attachment, potentially reducing planktonic Methanosarcina abundance while sustaining high methanogenesis rates by attached cells. This remains to be validated in future work.

To investigate the impact of −0.7 V on the partnership between Geobacter and Methanosarcina, we analysed changes in cell ratios. If partners are decoupled by a competitive electron donor for the methanogen (−0.7 V), the ratio of Geobacter to Methanosarcina is expected to drop. Indeed, we observed a significant drop in the ratio of Geobacter to Methanosarcina at −0.7 V compared to DIET controls, which became more pronounced under a biogas atmosphere (p < 0.05, Table S5, Figure S2). These findings suggest that the Geobacter–Methanosarcina partnership is decoupled by −0.7 V.

These results challenge the prevailing assumption that DIET partnerships are favoured on a cathode in MEC-AD (Zhao et al., 2015; Zhao et al., 2016; Liu et al., 2016; Wang et al., 2020; Zhao et al., 2022; Wang et al., 2022; Jiang et al., 2022; Lu et al., 2023; Wei et al., 2023). Our results indicate that a Geobacter capable of DIET does not find the cathodic conditions favourable at all. These insights highlight the complexity of microbial interactions in bioelectrochemical systems and emphasize the need for further research to fully understand the underlying mechanisms in MEC-AD, including the intricate dynamics of Methanosarcina in response to electrochemical conditions.

Implications of microbial syntrophy to MEC-AD

In AD, interspecies interactions play a pivotal role in promoting efficient methanogenesis from complex substrates. However, in the context of microbial electrochemical anaerobic digestion (MEC-AD), these interactions are subject to the influence of specific parameters, including applied voltage and gaseous atmosphere.

The coexistence of diverse microbial species on the electrodes during the application of electrical current may not solely result from syntrophic partnerships but rather from the preference of specific microorganisms for distinct respiratory niches available in MEC-AD. For instance, electrogenic bacteria such as Geobacter may thrive at the anode surface due to their ability to oxidize organic matter and generate electricity. Network analyses conducted by Zakaria and Ranjan Dhar (2022) confirmed potential interspecies interactions at the anode between Geobacter, Methanosaeta, and Methanobacterium. This association could be established by Geobacter oxidizing organic compounds and releasing acetate and hydrogen, which are subsequently utilized by Methanosaeta and Methanobacterium for their respective methanogenesis pathways (Zakaria & Ranjan Dhar, 2022). Similarly, at the cathode surface, network analyses demonstrated a linkage between Methanosarcina and acetogens. However, the predominant interaction between these two groups is most likely competition for cathodic electrons (Zakaria & Ranjan Dhar, 2022).

Nevertheless, while many studies have noted Geobacter's abundance at the cathode surface, the specific interplay between Geobacter and coexisting methanogens remains unexplored (Liu et al., 2016; Lu et al., 2023; Wang et al., 2020; Wei et al., 2023; Zhao et al., 2016, 2022). It is plausible that cathodic Geobacter may consume cathodic electrons (or H2) while respiring fermentation products from MEC-AD, such as fumarate – a common metabolism in numerous Geobacter species (Lovley et al., 2011). In such cases, Geobacter would likely engage in competition with methanogens for cathodic electrons.

Further dedicated investigations are warranted to determine the actual interplay between electroactive microorganisms and methanogens in MEC-AD. Such studies hold significant promise for advancing our understanding of microbial interactions and optimizing MEC-AD processes to facilitate the development of sustainable and efficient bioenergy solutions.

CONCLUSION

In conclusion, our study challenges the prevailing belief that cathodic current promotes methanogenesis by DIET consortia. A consortium of Geobacter metallireducens and Methanosarcina barkeri exposed to a poised −0.7 V electrode exhibited reduced metabolic activity and lower cell numbers. The presence of a cathode as an alternative electron donor limited efficient electron retrieval by Methanosarcina from Geobacter, leading to the catabolic repression of oxidative metabolism in Geobacter. Despite Methanosarcina retaining methane production at −0.7 V, a significant fraction of the recovered electrons was diverted into acetate. Combining these results indicates that cathodic potentials promote the decoupling of the partnership between Geobacter and Methanosarcina.

This underscores the importance of understanding the specific and combined effects of reactor parameters (electrical exposure and gas atmosphere) on key species in MEC-AD. Such insights are essential for optimizing methane production and improving tailored interspecies partnerships in future microbial electrochemical technologies.

AUTHOR CONTRIBUTIONS

Mon Oo Yee: Conceptualization (equal); data curation (equal); formal analysis (lead); investigation (lead); methodology (lead); validation (equal); visualization (equal); writing – original draft (lead); writing – review and editing (supporting). Lars Ditlev Mørck Ottosen: Conceptualization (supporting); funding acquisition (lead); project administration (supporting); supervision (supporting); writing – review and editing (supporting). Amelia-Elena Rotaru: Conceptualization (equal); data curation (equal); formal analysis (supporting); funding acquisition (supporting); investigation (supporting); methodology (supporting); project administration (lead); resources (lead); supervision (lead); validation (lead); visualization (lead); writing – original draft (supporting); writing – review and editing (lead).

ACKNOWLEDGEMENTS

The work was a contribution to a grant from the Innovationsfonden Denmark awarded to LDMO at Aarhus University (grant no. 4106–00017). During the writing of this manuscript, AER was supported by the Novo Nordisk Foundation grant NNF21OC0067353, the Danish Research Council grant DFF 1026-00159, and the European Research Council ERC-CoG grant 101045149. We would like to thank Lasse Ørum-Smidt and Heidi Grøn Jensen for laboratory assistance.

    CONFLICT OF INTEREST STATEMENT

    The authors have no conflicts of interest to declare.